bsmbidigested plenticrispr v2 vector backbone (Addgene inc)

Addgene inc is a verified supplier

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Addgene inc bsmbidigested plenticrispr v2 vector backbone
Bsmbidigested Plenticrispr V2 Vector Backbone, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 6234 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/backbone+vector/lentiCRISPR+v2+(Plasmid+%2352961)/pm42880285-1487-34-38
Average 96 stars, based on 6234 article reviews

bsmbidigested plenticrispr v2 vector backbone - by Bioz Stars, 2026-11

96/100 stars

Images

Expressing:

Article Title: In vivo adenine base editing rescues adrenoleukodystrophy in a humanized mouse model.
Article Snippet: 1Department of Pharmacology, Yonsei University College ofMedicine, Seoul 03722, Republic of Korea; 2Brain Korea 21 Plus Project for Medical Sciences, Yonsei University College of Medicine, Seoul 03722, Republic of Korea; 3ConveRgence mEDIcine research cenTer (CREDIT), ASAN Institute for Life Sciences, ASAN Medical Center, Seoul 05505, Republic of Korea; 4Department of Cell and Genetic Engineering, ASAN Medical Center, University of Ulsan College of Medicine, Seoul 05505, Republic of Korea; 5JES Clinic, Incheon 21550, Republic of Korea; 6Department of PrecisionMedicine, SungkyunkwanUniversity School of Medicine, Suwon 16419, Republic of Korea; 7Center for Nanomedicine, Institute for Basic Science, Seoul 03722, Republic of Korea; 8Graduate Program of Nano Biomedical Engineering, Advanced Science Institute, Yonsei University, Seoul 03722, Republic of Korea; 9Severance Biomedical Science Institute, Yonsei University College of Medicine, Seoul 03722, Republic of Korea; 10Institute for Immunology and Immunological Diseases, Yonsei University College of Medicine, Seoul 03722, Republic of Korea; 11Woo Choo Lee Institute for Precision Drug

Plasmid Preparation:

Article Title: The RhoB p.S73F mutation leads to cerebral palsy through dysregulation of lipid homeostasis.
Article Snippet: The LYN-EGFP overexpression plasmid (mEGFP-N1-LYN) and ACAT1-EGFP overexpression plasmid (mEGFP-N1-ACAT1) were constructed by cloning the corresponding coding sequences into the mEGFP-N1 vector from Addgene (#54767); the ACAT1mCherry overexpression plasmid (pmCherry-C1-ACAT1) were constructed by cloning the corresponding coding sequences into the pmCherry-C1 vector; the LYN Y397D-EGFP overexpression plasmid (mEGFP-N1-LYN Y397D), ACAT1 Y214D, Y219D, Y407D-EGFP overexpression plasmid (mEGFP-N1-ACAT1-M), and ACAT1 Y214D, Y219D, Y407D-EGFP overexpression plasmid (pmCherry-C1-ACAT1-M) were constructed using the Fast SiteDirected Mutagenesis Kit (Tiangen, KM101). .. For gene knockout, Cas-Designer (http://www.rgenome.net/casdesigner/) was used to design the sgRNAs (sgRNA1: TCTATTCCAACAGGAAATAT; sgRNA2: CCAGTAAGTAGACTAGTCTC; sgRNA3: GTGGCCTTATACCCTTATGA; sgRNA4: GCTGGG ACCTACTTGCTGCT); sgRNAs were inserted into the backbone vector from Addgene (#51133). ..

Article Title: CRISPR-based screening identifies the role of KRAB-containing transcription factors ZIM3 and ZNF394 in human major zygotic genome activation.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Bowtie2 v2.5.4 Langmead et al.59 https://bowtie-bio.sourceforge.net/bowtie2/ index.shtml MAC2 v2.1.4 Zhang et al.60 https://github.com/jdavisturak/MACS2-2.1.1.20160309 Deeptools v3.3.0 Ramı́rez et al.61 https://test-argparse-readoc.readthedocs.io/ en/latest/content/installation.html CHIPseeker v1.30.3 Wang et al.62 https://bioconductor.org/packages/release/ bioc/html/ChIPseeker.html DiffBind v3.4.11 Cancer Research UK’s Cambridge Research Institute https://bioconductor.org/packages/release/ bioc/html/DiffBind.html MEME-suite v5.5.7 Timothy et al.63 https://meme-suite.org Graphpad Prism v9.0 Dotmatics https://www.graphpad.com/scientific-software/ prism/www.graphpad.com/scientific-software/ prism/ Other GTRD database Yevshin et al.49 http://gtrd.biouml.org DAVID database for GO and KEGG analysis Sherman et al.64 https://davidbioinformatics.nih.gov/ STRING database for PPI analysis Szklarczyk et al.65 N/A hORFeome Broad Institute N/A Cell Reports 44, 116015, August 26, 2025 23 .. For plasmid PB-idCas9-VPR-NeoR, the backbone vector was originated from PB-TRE-dCas9-VPR (addgene#63800), while the HygR sequence was replaced by NeoR sequence. .. For plasmid PB-DUXA-pMaxGFP-NLS-PGK-HygR, the regulatory sequence started from − 2 kb to transcription start site (TSS) of human DUXA gene was synthesized by Genscript.

Article Title: The RhoB p.S73F mutation leads to cerebral palsy through dysregulation of lipid homeostasis.
Article Snippet: N2a and stable RhoBS73F/S73F cells were cultured in DMEM (Gibco, 11965092) containing 10% fetal bovine serum (FBS, Clark Bioscience). .. To construct the RhoBS73F/S73F mutant N2a cell line, sgRNA targeting the murine-derived locus was inserted into the backbone vector from Addgene (#51133). ..

Article Title: LIPA , a risk locus for coronary artery disease: decoding the variant-to-function relationship
Article Snippet: .. Specifically, mouse Lipa open reading frame ( NM_001111100 ) was cloned into the backbone vector (Addgene, 74285) 28 with a final construct (left homologous arm-CAG-loxP-STOP-loxP-Lipa-IRES-eGFP-right homologous arm) for the knock-in (KI) of the insert into the Rosa26 locus ( Lipa KI/WT ) and was bred to obtain ( Lipa KI/KI ). ..

Article Title: A high affinity Sybody blocks Cofilin-1 binding to F-actin in vitro and in cancer cells.
Article Snippet: .. For the construction of the pET AviTag-His6-Cofilin-1 vector (Plasmid 1), Cofilin1 cDNA was amplified using Primer 1 and Primer 2, while the backbone vector (pET Biotin His6 FlAsH LIC cloning vector, Addgene Plasmid #30184, Addgene, Massachusetts, USA) was amplified with Primer 3 and Primer 4. .. Similarly, for the pSF 10His-GFP-TEV-Cofilin-1 (Plasmid 2) vector, the Cofilin-1 cDNA was amplified from the pET AviTag-His6-Cofilin-1 vector (Plasmid 1) using Primer 5 and Primer 6, while the backbone (pSF 10His-GFP-TEV-ITPKA vector, Plasmid 11 see [36] was amplified using Primer 7 and Primer 8.

Bioprocessing:

Modification:

Generated:

Sequencing:

Polymerase Chain Reaction:

Amplification:

Article Title: SWI/SNF ATPase silenced HLF potentiates lung metastasis in solid cancers.
Article Snippet: Virus Infection For lentiviral plasmids, 293 T cells were used for virus production by co-transfection of the psPAX2 (Addgene, 12260) and pMD2.G (Addgene, 12259) in Opti-MEM with the addition of Lipofectamine 3000. .. The pFETCh_Donor (EMM0021, Addgene #63934) backbone vector was digested using BsaI and BbsI, followed by single step gibson assembly reaction with amplified gBlocks. ..

Gene Knockout:

Construct:

Mutagenesis:

Clone Assay:

Knock-In:

other:

Article Title: SWI/SNF ATPase silenced HLF potentiates lung metastasis in solid cancers
Article Snippet: For pLX304- FOSB / AJAP1 / HTRA1 , pDONR201- FOSB (HsCD00001737)/ pDONR221- AJAP1 (HsCD00877134)/ pDONR221- HTRA1 (HsCD00860462) were acquired from DNASU, and were cloned into pLX304 backbone (Addgene, 25890).

Review