bbsi digested pxr003 vector (Addgene inc)
Addgene inc is a verified supplier 
95
Structured Review
Addgene inc
bbsi digested pxr003 vector
Bbsi Digested Pxr003 Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 71 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/backbone+vector/pXR003%3A+CasRx+gRNA+cloning+backbone+(Plasmid+%23109053)/pm41928225-94-9-12
Average 95 stars, based on 71 article reviews
Bbsi Digested Pxr003 Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 71 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/backbone+vector/pXR003%3A+CasRx+gRNA+cloning+backbone+(Plasmid+%23109053)/pm41928225-94-9-12
Average 95 stars, based on 71 article reviews
bbsi digested pxr003 vector - by Bioz Stars,
2026-09
95/100 stars
Images
Related Articles
Expressing:Article Title: In vivo adenine base editing rescues adrenoleukodystrophy in a humanized mouse model. Article Snippet: 1Department of Pharmacology, Yonsei University College ofMedicine, Seoul 03722, Republic of Korea; 2Brain Korea 21 Plus Project for Medical Sciences, Yonsei University College of Medicine, Seoul 03722, Republic of Korea; 3ConveRgence mEDIcine research cenTer (CREDIT), ASAN Institute for Life Sciences, ASAN Medical Center, Seoul 05505, Republic of Korea; 4Department of Cell and Genetic Engineering, ASAN Medical Center, University of Ulsan College of Medicine, Seoul 05505, Republic of Korea; 5JES Clinic, Incheon 21550, Republic of Korea; 6Department of PrecisionMedicine, SungkyunkwanUniversity School of Medicine, Suwon 16419, Republic of Korea; 7Center for Nanomedicine, Institute for Basic Science, Seoul 03722, Republic of Korea; 8Graduate Program of Nano Biomedical Engineering, Advanced Science Institute, Yonsei University, Seoul 03722, Republic of Korea; 9Severance Biomedical Science Institute, Yonsei University College of Medicine, Seoul 03722, Republic of Korea; 10Institute for Immunology and Immunological Diseases, Yonsei University College of Medicine, Seoul 03722, Republic of Korea; 11Woo Choo Lee Institute for Precision Drug Plasmid Preparation:Article Title: In vivo adenine base editing rescues adrenoleukodystrophy in a humanized mouse model. Article Snippet: 1Department of Pharmacology, Yonsei University College ofMedicine, Seoul 03722, Republic of Korea; 2Brain Korea 21 Plus Project for Medical Sciences, Yonsei University College of Medicine, Seoul 03722, Republic of Korea; 3ConveRgence mEDIcine research cenTer (CREDIT), ASAN Institute for Life Sciences, ASAN Medical Center, Seoul 05505, Republic of Korea; 4Department of Cell and Genetic Engineering, ASAN Medical Center, University of Ulsan College of Medicine, Seoul 05505, Republic of Korea; 5JES Clinic, Incheon 21550, Republic of Korea; 6Department of PrecisionMedicine, SungkyunkwanUniversity School of Medicine, Suwon 16419, Republic of Korea; 7Center for Nanomedicine, Institute for Basic Science, Seoul 03722, Republic of Korea; 8Graduate Program of Nano Biomedical Engineering, Advanced Science Institute, Yonsei University, Seoul 03722, Republic of Korea; 9Severance Biomedical Science Institute, Yonsei University College of Medicine, Seoul 03722, Republic of Korea; 10Institute for Immunology and Immunological Diseases, Yonsei University College of Medicine, Seoul 03722, Republic of Korea; 11Woo Choo Lee Institute for Precision Drug Article Title: The RhoB p.S73F mutation leads to cerebral palsy through dysregulation of lipid homeostasis. Article Snippet: The LYN-EGFP overexpression plasmid (mEGFP-N1-LYN) and ACAT1-EGFP overexpression plasmid (mEGFP-N1-ACAT1) were constructed by cloning the corresponding coding sequences into the mEGFP-N1 vector from Addgene (#54767); the ACAT1mCherry overexpression plasmid (pmCherry-C1-ACAT1) were constructed by cloning the corresponding coding sequences into the pmCherry-C1 vector; the LYN Y397D-EGFP overexpression plasmid (mEGFP-N1-LYN Y397D), ACAT1 Y214D, Y219D, Y407D-EGFP overexpression plasmid (mEGFP-N1-ACAT1-M), and ACAT1 Y214D, Y219D, Y407D-EGFP overexpression plasmid (pmCherry-C1-ACAT1-M) were constructed using the Fast SiteDirected Mutagenesis Kit (Tiangen, KM101). .. For gene knockout, Cas-Designer (http://www.rgenome.net/casdesigner/) was used to design the sgRNAs (sgRNA1: TCTATTCCAACAGGAAATAT; sgRNA2: CCAGTAAGTAGACTAGTCTC; sgRNA3: GTGGCCTTATACCCTTATGA; sgRNA4: GCTGGG ACCTACTTGCTGCT); sgRNAs were inserted into the Article Title: CRISPR-based screening identifies the role of KRAB-containing transcription factors ZIM3 and ZNF394 in human major zygotic genome activation. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Bowtie2 v2.5.4 Langmead et al.59 https://bowtie-bio.sourceforge.net/bowtie2/ index.shtml MAC2 v2.1.4 Zhang et al.60 https://github.com/jdavisturak/MACS2-2.1.1.20160309 Deeptools v3.3.0 Ramı́rez et al.61 https://test-argparse-readoc.readthedocs.io/ en/latest/content/installation.html CHIPseeker v1.30.3 Wang et al.62 https://bioconductor.org/packages/release/ bioc/html/ChIPseeker.html DiffBind v3.4.11 Cancer Research UK’s Cambridge Research Institute https://bioconductor.org/packages/release/ bioc/html/DiffBind.html MEME-suite v5.5.7 Timothy et al.63 https://meme-suite.org Graphpad Prism v9.0 Dotmatics https://www.graphpad.com/scientific-software/ prism/www.graphpad.com/scientific-software/ prism/ Other GTRD database Yevshin et al.49 http://gtrd.biouml.org DAVID database for GO and KEGG analysis Sherman et al.64 https://davidbioinformatics.nih.gov/ STRING database for PPI analysis Szklarczyk et al.65 N/A hORFeome Broad Institute N/A Cell Reports 44, 116015, August 26, 2025 23 .. For plasmid PB-idCas9-VPR-NeoR, the Article Title: The RhoB p.S73F mutation leads to cerebral palsy through dysregulation of lipid homeostasis. Article Snippet: N2a and stable RhoBS73F/S73F cells were cultured in DMEM (Gibco, 11965092) containing 10% fetal bovine serum (FBS, Clark Bioscience). .. To construct the RhoBS73F/S73F mutant N2a cell line, sgRNA targeting the murine-derived locus was inserted into the Article Title: LIPA , a risk locus for coronary artery disease: decoding the variant-to-function relationship Article Snippet: .. Specifically, mouse Lipa open reading frame ( NM_001111100 ) was cloned into the Article Title: A high affinity Sybody blocks Cofilin-1 binding to F-actin in vitro and in cancer cells. Article Snippet: .. For the construction of the pET AviTag-His6-Cofilin-1 vector (Plasmid 1), Cofilin1 cDNA was amplified using Primer 1 and Primer 2, while the Bioprocessing:Article Title: In vivo adenine base editing rescues adrenoleukodystrophy in a humanized mouse model. Article Snippet: 1Department of Pharmacology, Yonsei University College ofMedicine, Seoul 03722, Republic of Korea; 2Brain Korea 21 Plus Project for Medical Sciences, Yonsei University College of Medicine, Seoul 03722, Republic of Korea; 3ConveRgence mEDIcine research cenTer (CREDIT), ASAN Institute for Life Sciences, ASAN Medical Center, Seoul 05505, Republic of Korea; 4Department of Cell and Genetic Engineering, ASAN Medical Center, University of Ulsan College of Medicine, Seoul 05505, Republic of Korea; 5JES Clinic, Incheon 21550, Republic of Korea; 6Department of PrecisionMedicine, SungkyunkwanUniversity School of Medicine, Suwon 16419, Republic of Korea; 7Center for Nanomedicine, Institute for Basic Science, Seoul 03722, Republic of Korea; 8Graduate Program of Nano Biomedical Engineering, Advanced Science Institute, Yonsei University, Seoul 03722, Republic of Korea; 9Severance Biomedical Science Institute, Yonsei University College of Medicine, Seoul 03722, Republic of Korea; 10Institute for Immunology and Immunological Diseases, Yonsei University College of Medicine, Seoul 03722, Republic of Korea; 11Woo Choo Lee Institute for Precision Drug Modification:Article Title: In vivo adenine base editing rescues adrenoleukodystrophy in a humanized mouse model. Article Snippet: 1Department of Pharmacology, Yonsei University College ofMedicine, Seoul 03722, Republic of Korea; 2Brain Korea 21 Plus Project for Medical Sciences, Yonsei University College of Medicine, Seoul 03722, Republic of Korea; 3ConveRgence mEDIcine research cenTer (CREDIT), ASAN Institute for Life Sciences, ASAN Medical Center, Seoul 05505, Republic of Korea; 4Department of Cell and Genetic Engineering, ASAN Medical Center, University of Ulsan College of Medicine, Seoul 05505, Republic of Korea; 5JES Clinic, Incheon 21550, Republic of Korea; 6Department of PrecisionMedicine, SungkyunkwanUniversity School of Medicine, Suwon 16419, Republic of Korea; 7Center for Nanomedicine, Institute for Basic Science, Seoul 03722, Republic of Korea; 8Graduate Program of Nano Biomedical Engineering, Advanced Science Institute, Yonsei University, Seoul 03722, Republic of Korea; 9Severance Biomedical Science Institute, Yonsei University College of Medicine, Seoul 03722, Republic of Korea; 10Institute for Immunology and Immunological Diseases, Yonsei University College of Medicine, Seoul 03722, Republic of Korea; 11Woo Choo Lee Institute for Precision Drug Generated:Article Title: In vivo adenine base editing rescues adrenoleukodystrophy in a humanized mouse model. Article Snippet: 1Department of Pharmacology, Yonsei University College ofMedicine, Seoul 03722, Republic of Korea; 2Brain Korea 21 Plus Project for Medical Sciences, Yonsei University College of Medicine, Seoul 03722, Republic of Korea; 3ConveRgence mEDIcine research cenTer (CREDIT), ASAN Institute for Life Sciences, ASAN Medical Center, Seoul 05505, Republic of Korea; 4Department of Cell and Genetic Engineering, ASAN Medical Center, University of Ulsan College of Medicine, Seoul 05505, Republic of Korea; 5JES Clinic, Incheon 21550, Republic of Korea; 6Department of PrecisionMedicine, SungkyunkwanUniversity School of Medicine, Suwon 16419, Republic of Korea; 7Center for Nanomedicine, Institute for Basic Science, Seoul 03722, Republic of Korea; 8Graduate Program of Nano Biomedical Engineering, Advanced Science Institute, Yonsei University, Seoul 03722, Republic of Korea; 9Severance Biomedical Science Institute, Yonsei University College of Medicine, Seoul 03722, Republic of Korea; 10Institute for Immunology and Immunological Diseases, Yonsei University College of Medicine, Seoul 03722, Republic of Korea; 11Woo Choo Lee Institute for Precision Drug Sequencing:Article Title: In vivo adenine base editing rescues adrenoleukodystrophy in a humanized mouse model. Article Snippet: 1Department of Pharmacology, Yonsei University College ofMedicine, Seoul 03722, Republic of Korea; 2Brain Korea 21 Plus Project for Medical Sciences, Yonsei University College of Medicine, Seoul 03722, Republic of Korea; 3ConveRgence mEDIcine research cenTer (CREDIT), ASAN Institute for Life Sciences, ASAN Medical Center, Seoul 05505, Republic of Korea; 4Department of Cell and Genetic Engineering, ASAN Medical Center, University of Ulsan College of Medicine, Seoul 05505, Republic of Korea; 5JES Clinic, Incheon 21550, Republic of Korea; 6Department of PrecisionMedicine, SungkyunkwanUniversity School of Medicine, Suwon 16419, Republic of Korea; 7Center for Nanomedicine, Institute for Basic Science, Seoul 03722, Republic of Korea; 8Graduate Program of Nano Biomedical Engineering, Advanced Science Institute, Yonsei University, Seoul 03722, Republic of Korea; 9Severance Biomedical Science Institute, Yonsei University College of Medicine, Seoul 03722, Republic of Korea; 10Institute for Immunology and Immunological Diseases, Yonsei University College of Medicine, Seoul 03722, Republic of Korea; 11Woo Choo Lee Institute for Precision Drug Article Title: CRISPR-based screening identifies the role of KRAB-containing transcription factors ZIM3 and ZNF394 in human major zygotic genome activation. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Bowtie2 v2.5.4 Langmead et al.59 https://bowtie-bio.sourceforge.net/bowtie2/ index.shtml MAC2 v2.1.4 Zhang et al.60 https://github.com/jdavisturak/MACS2-2.1.1.20160309 Deeptools v3.3.0 Ramı́rez et al.61 https://test-argparse-readoc.readthedocs.io/ en/latest/content/installation.html CHIPseeker v1.30.3 Wang et al.62 https://bioconductor.org/packages/release/ bioc/html/ChIPseeker.html DiffBind v3.4.11 Cancer Research UK’s Cambridge Research Institute https://bioconductor.org/packages/release/ bioc/html/DiffBind.html MEME-suite v5.5.7 Timothy et al.63 https://meme-suite.org Graphpad Prism v9.0 Dotmatics https://www.graphpad.com/scientific-software/ prism/www.graphpad.com/scientific-software/ prism/ Other GTRD database Yevshin et al.49 http://gtrd.biouml.org DAVID database for GO and KEGG analysis Sherman et al.64 https://davidbioinformatics.nih.gov/ STRING database for PPI analysis Szklarczyk et al.65 N/A hORFeome Broad Institute N/A Cell Reports 44, 116015, August 26, 2025 23 .. For plasmid PB-idCas9-VPR-NeoR, the Polymerase Chain Reaction:Article Title: In vivo adenine base editing rescues adrenoleukodystrophy in a humanized mouse model. Article Snippet: 1Department of Pharmacology, Yonsei University College ofMedicine, Seoul 03722, Republic of Korea; 2Brain Korea 21 Plus Project for Medical Sciences, Yonsei University College of Medicine, Seoul 03722, Republic of Korea; 3ConveRgence mEDIcine research cenTer (CREDIT), ASAN Institute for Life Sciences, ASAN Medical Center, Seoul 05505, Republic of Korea; 4Department of Cell and Genetic Engineering, ASAN Medical Center, University of Ulsan College of Medicine, Seoul 05505, Republic of Korea; 5JES Clinic, Incheon 21550, Republic of Korea; 6Department of PrecisionMedicine, SungkyunkwanUniversity School of Medicine, Suwon 16419, Republic of Korea; 7Center for Nanomedicine, Institute for Basic Science, Seoul 03722, Republic of Korea; 8Graduate Program of Nano Biomedical Engineering, Advanced Science Institute, Yonsei University, Seoul 03722, Republic of Korea; 9Severance Biomedical Science Institute, Yonsei University College of Medicine, Seoul 03722, Republic of Korea; 10Institute for Immunology and Immunological Diseases, Yonsei University College of Medicine, Seoul 03722, Republic of Korea; 11Woo Choo Lee Institute for Precision Drug Amplification:Article Title: In vivo adenine base editing rescues adrenoleukodystrophy in a humanized mouse model. Article Snippet: 1Department of Pharmacology, Yonsei University College ofMedicine, Seoul 03722, Republic of Korea; 2Brain Korea 21 Plus Project for Medical Sciences, Yonsei University College of Medicine, Seoul 03722, Republic of Korea; 3ConveRgence mEDIcine research cenTer (CREDIT), ASAN Institute for Life Sciences, ASAN Medical Center, Seoul 05505, Republic of Korea; 4Department of Cell and Genetic Engineering, ASAN Medical Center, University of Ulsan College of Medicine, Seoul 05505, Republic of Korea; 5JES Clinic, Incheon 21550, Republic of Korea; 6Department of PrecisionMedicine, SungkyunkwanUniversity School of Medicine, Suwon 16419, Republic of Korea; 7Center for Nanomedicine, Institute for Basic Science, Seoul 03722, Republic of Korea; 8Graduate Program of Nano Biomedical Engineering, Advanced Science Institute, Yonsei University, Seoul 03722, Republic of Korea; 9Severance Biomedical Science Institute, Yonsei University College of Medicine, Seoul 03722, Republic of Korea; 10Institute for Immunology and Immunological Diseases, Yonsei University College of Medicine, Seoul 03722, Republic of Korea; 11Woo Choo Lee Institute for Precision Drug Article Title: SWI/SNF ATPase silenced HLF potentiates lung metastasis in solid cancers. Article Snippet: gBlocks of 500 ~ 600 bp homology arms were synthesized in IDT corporation, followed by PCR amplification. .. The pFETCh_Donor (EMM0021, Addgene #63934) Article Title: SWI/SNF ATPase silenced HLF potentiates lung metastasis in solid cancers Article Snippet: gBlocks of 500 ~ 600 bp homology arms were synthesized in IDT corporation, followed by PCR amplification. .. The pFETCh_Donor (EMM0021, Addgene #63934) Article Title: A high affinity Sybody blocks Cofilin-1 binding to F-actin in vitro and in cancer cells. Article Snippet: .. For the construction of the pET AviTag-His6-Cofilin-1 vector (Plasmid 1), Cofilin1 cDNA was amplified using Primer 1 and Primer 2, while the Gene Knockout:Article Title: The RhoB p.S73F mutation leads to cerebral palsy through dysregulation of lipid homeostasis. Article Snippet: The LYN-EGFP overexpression plasmid (mEGFP-N1-LYN) and ACAT1-EGFP overexpression plasmid (mEGFP-N1-ACAT1) were constructed by cloning the corresponding coding sequences into the mEGFP-N1 vector from Addgene (#54767); the ACAT1mCherry overexpression plasmid (pmCherry-C1-ACAT1) were constructed by cloning the corresponding coding sequences into the pmCherry-C1 vector; the LYN Y397D-EGFP overexpression plasmid (mEGFP-N1-LYN Y397D), ACAT1 Y214D, Y219D, Y407D-EGFP overexpression plasmid (mEGFP-N1-ACAT1-M), and ACAT1 Y214D, Y219D, Y407D-EGFP overexpression plasmid (pmCherry-C1-ACAT1-M) were constructed using the Fast SiteDirected Mutagenesis Kit (Tiangen, KM101). .. For gene knockout, Cas-Designer (http://www.rgenome.net/casdesigner/) was used to design the sgRNAs (sgRNA1: TCTATTCCAACAGGAAATAT; sgRNA2: CCAGTAAGTAGACTAGTCTC; sgRNA3: GTGGCCTTATACCCTTATGA; sgRNA4: GCTGGG ACCTACTTGCTGCT); sgRNAs were inserted into the Construct:Article Title: The RhoB p.S73F mutation leads to cerebral palsy through dysregulation of lipid homeostasis. Article Snippet: N2a and stable RhoBS73F/S73F cells were cultured in DMEM (Gibco, 11965092) containing 10% fetal bovine serum (FBS, Clark Bioscience). .. To construct the RhoBS73F/S73F mutant N2a cell line, sgRNA targeting the murine-derived locus was inserted into the Article Title: LIPA , a risk locus for coronary artery disease: decoding the variant-to-function relationship Article Snippet: .. Specifically, mouse Lipa open reading frame ( NM_001111100 ) was cloned into the Mutagenesis:Article Title: The RhoB p.S73F mutation leads to cerebral palsy through dysregulation of lipid homeostasis. Article Snippet: N2a and stable RhoBS73F/S73F cells were cultured in DMEM (Gibco, 11965092) containing 10% fetal bovine serum (FBS, Clark Bioscience). .. To construct the RhoBS73F/S73F mutant N2a cell line, sgRNA targeting the murine-derived locus was inserted into the Clone Assay:Article Title: LIPA , a risk locus for coronary artery disease: decoding the variant-to-function relationship Article Snippet: .. Specifically, mouse Lipa open reading frame ( NM_001111100 ) was cloned into the Knock-In:Article Title: LIPA , a risk locus for coronary artery disease: decoding the variant-to-function relationship Article Snippet: .. Specifically, mouse Lipa open reading frame ( NM_001111100 ) was cloned into the Cloning:Article Title: A high affinity Sybody blocks Cofilin-1 binding to F-actin in vitro and in cancer cells. Article Snippet: .. For the construction of the pET AviTag-His6-Cofilin-1 vector (Plasmid 1), Cofilin1 cDNA was amplified using Primer 1 and Primer 2, while the |